National Geographic

I’ve got your missing links right here (17 August 2013)

Top picks

How to Build an Ice Wall Around a Leaking Nuclear Reactor. By Alexis Madrigal, featuring an interview with a guy who is Director of Ground Freezing.

An insightful read: What the Science Tells Us About “Trust in Science”, by Liz Neeley.

Elizabeth Loftus has spent decades exposing flaws in eyewitness testimony.” – Great profile by Mo Costandi.

Chronic excreters” – not a description of Twitter users, but a threat to polio eradication. By Helen Branswell.

On the trail of a new snakebite treatment, an unidentified scientist volunteers to be injected with a simulated cobra bite.

What makes the ouija board move, and what it says about your brain. Fascinating read by Tom Stafford.

A new test for gauging consciousness in an unresponsive patient that requires no participation by the individual

Tim de Chant pulls the hype out of the Hyperloop, leaving only an rloop.

A virus laid waste to James Wilson’s career; another could offer redemption. Carl Zimmer on rise/fall of gene therapy

Before denoting a type of machine, “engine” referred to the abstract concept of ingenuity. By Becca Rosen.

This Ian Sample piece on a new species of raccoon-like carnivore (wait for it…) discovered in Ecuador is wonderful.

Data everywhere! Old Hawaiian restaurant menus hoarded by tourists reveal changing ocean health. By Rachel Nuwer.

It Costs $5 Billion To Create A Drug, by Matthew Herper. And an astonishing fact from that piece: the number of drugs invented per billion dollars of R&D has halved every 9yrs for half a century

Skilfully told story about a grassroots approach to fuelling research on orphan genetic diseases. By Jude Isabella.

Fascinating idea – send endangered plants through botanical gardens, as stepping stones in an assisted migration. By Virginia Gewin.

Psychology is a science. Shut up about how it’s not, already.” By Melanie Tannenbaum. Good response to a tired debate.

Science/news/writing

The evolution of the hyperswarmers.

This is… maybe not the most catastrophic consequence of climate change?

A real shame: Psychology paper retracted when data behind problematic findings disappear

Cool new cancer gene study points to the disease’s origins.

“I have not been stung by a velvet ant since—I will not be stung by a velvet ant again.”

Do antidepressants work? Well, it’s complicated

People will swallow all sorts of bollocks about testicle-eating fish

That time the US tried to put a ring of copper around the Earth.

“As a general rule, it seems, humans will always find ways to join cats and series of tubes.” Heh.

How to Love a Whale Shark

Why don’t giraffes fall over more often?

“One of the ways that she’s studying [the yellow slime mould] is with this expressive robot.”

Pixar Changes Ending of ‘Finding Nemo’ Sequel, Won’t Promote Captivity

Alex Warneke explains why Discovery Channel’s scientific integrity (or lack thereof) matters: “These kids are paying attention.”

NatGeo’s hosting a G+ hangout on epic fails of science exploration. Wed 28 Aug, 1pm

Gibbon mums give daughters singing lessons

Great coverage of Arclight, a cool new neuroscience technique

Language, it turns out, affects not only what we see, but whether we see anything at all.

Patient shows he is aware of his identity and whereabouts after 12yrs in vegetative state

Another good post on the study that I covered on weird brain activity after clinical death, by Chris Chambers.

Five psychological tools for tackling trolls and online abusers

Aussie university halts trials of skin cancer drug whose developer has four retractions

Before it spins a cocoon, this caterpillar weaves its hairs into several protective walls.

Gina Kolata tackles autism, cancer & genes. The results are as dire as you’d expect. Thankfully there’s Emily Willingham.

Our Brains CANNOT (Unconsciously) Save Us from Temptation, according to one new study

Heh/wow/huh

Scientists Finally Pronounce Human Genome. ‘It’s Gatcaatgaggtggacaccagaggc…’

“Authorities recently gave the man 15 days to remove the mountain or else it will face forcible removal”

Oh, so THAT’S what this paper is about. Wait, WHAT?

Beyond black and yellow: a spectacular rainbow of bees.

AHAHAHA. George Takei is such a legend.

This is a picture of a shark eating another shark.

Awesome police dept trolling.

A Chinese zoo’s supposed “African lion” was exposed as a fraud when the dog used as a substitute started barking

Well, at least the people who bought space on the top floors will get some exercise.

Today I learned that Italy used to have a giant hedgehog. It was the size of a cat and looked terrifying

Extreme close-ups of sea urchins reveal extreme beauty

The tiger spider is absolutely stunning.

Journalism/internet/society

I’ve very chuffed to be on Wired’s 101 Signals list with such esteemed peers as Maggie Koerth-Baker, Helen Branswell, Kyle Hill, Mara Grunbaum, Ivan Oransky, Leonid Kruglyak, Bora Zivkovic and the LWON crew. This is sad, though.

“The play’s the thing / Wherein I’ll catch this batsh*t filtering” – British Library blocks Hamlet

New York Post fires the guy who wrote “Headless Body in Topless Bar” headline

The Mail still can’t quite live with the shame that it has always, always been historically wrong about everything” – Stephen Fry.

Magazine Writing On the Web, For Film

How far can you get into this piece without smashing your head against your desk?

He made “the hook from Hook, the blade from Blade”: Meet the blacksmith who makes armour and weapons for Hollywood

People Worship Weeping Tree In California, Tears Are Actually Insect Excrement

What do believers believe? Fascinating look at the plurality of views amongst people of faith

 

 

There are 2 Comments. Add Yours.

  1. Adrian Morgan
    August 18, 2013

    On the pronunciation of the genome, I lean to the view that we should use ♥, ♦, ♠ & ♣ instead of G, C, A & T (the memonic links, based on the shapes of the letterforms, are obvious). So “gatcaatgaggtggacaccagaggc” would be “♥♠♣♦♠♠♣♥♠♥♥♣♥♥♠♦♠♦♦♠♥♠♥♥♦”.

    Advantage: It’s intrinsically more fun. Disadvantage: As far as I know, nobody ever actually writes out genetic sequences except in introductory articles about genetics, so there wouldn’t be much opportunity to use it.

  2. Adrian Morgan
    August 18, 2013

    Also: the Hollywood blacksmith link goes to a blank page, but I found the article at a slightly different URL.

Add Your Comments

All fields required.

Related Posts